Hama time control 112 инструкция
Therefore, a long-distance component is needed to transmit the information from photoreceptors in leaves to GA biosynthesis in tubers and flower induction in the shoot apical meristem. Several phloem-mobile signaling molecules are discussed and Suc itself might play a role as a phloem-mobile signaling molecule Smeekens, It is also discussed that assimilates act as a part of a complex flowering signal Bernier and Perilleux, because photosynthesis and photoperiodism were shown to interact in flower induction Friend, The Arabidopsis flowering time in noninductive SD conditions is determined by sharp increases of GA4 and Suc in the apical meristem shortly before flower initiation Eriksson et al.
Graft experiments between phyB antisense and wild-type potato plants revealed that a graft-transmissible inhibitor of tuberization is responsible for inhibition of potato tuber induction under noninductive LD conditions Jackson et al. It is also known that phytochromes act by transferring a leaf-derived signal toward the shoot apical meristem to induce flowering Valverde et al.
Suc as a Signaling Molecule. Strong expression of StSUT4 in flowers and tubers argues for an important role of this membrane protein in sink organs. Nevertheless, the observed effects regarding photoperiodically regulated developmental processes in StSUT4-RNAi plants like early flowering and tuberization under LD conditions are graft transmissible and depend on the presence or absence of source leaves, indicating Hama time control 112 инструкция important role of SUT4 not only in sink tissues, but also in source leaves where photoperception occurs.
Real-time PCR data were Hama time control 112 инструкция by calculation of the PCR efficiency individually using LinReg PCR software. Isolation of the microsomal fraction from plant material as well as two-phase partitioning and western blotting were performed as previously described Lemoine et al. The StSUT4-specific peptide antibody is raised against a central loop peptide of SUT4 NH2-CGSSHTGEEIDESSHGQEEAFLW-CONH2. The specificity of the affinity-purified antibody has been tested previously and the purified antibody was used for immunolocalization as well as western-blot analysis Weise et al.
Thus, far-red light exceeded red light at least 3-fold Hama time control 112 инструкция shading experiments. Dark samples were taken under a green light source in the phytochamber. Control plants were sprayed Hama time control 112 инструкция water containing two drops of Triton X All chemicals were purchased from Sigma-Aldrich. Control plants were exposed to white light alone. Plants had four to five leaves in total when grafted.
For construction of the RNAi construct, a bp fragment of StSUT4 cDNA was amplified with primers forward, TATGGTACCATGCCGGAGATATAGAAAGG and reverse, GAGACTCGAGTGCAAAGATCTTGGGTTTCTC, digested with XhoI and SmaI, and cloned into the SalI and SmaI sites of pRT-RNAi. A second StSUT4 fragment Hama time control 112 инструкция digested was inserted via the XhoI and EclI sites into pRT-RNAi. Gene transfer into plants was performed with Agrobacterium tumefaciens strain C58C1, pGV; Deblaere et al.
Received November 2,
The experiment was performed as described elsewhere Martinez-Garcia et al. Analysis of Enzyme Activity Hama time control 112 инструкция Determination of Soluble Sugars. RNA Quantification by Real-Time PCR. Reverse transcription RT was performed with the Qiagen Omniscript RT kit according to the manual. Relative quantification of transcript amounts was always calculated in relation to the respective ubiquitin transcript level and given as percentage of ubiquitin.
Download as PowerPoint Slide. Hypothetical model of StSUT4-mediated interconnection of the photoreceptor and the GA3 signaling pathway triggering tuberization, flowering, and shade avoidance response. The model is partially adapted from Rodriguez-Falcon et al. Hama time control 112 инструкция Is Involved in GA Signaling. PhyB action negatively affects flowering in LD plants and inhibits tuberization in potato plants Jackson and Prat, ; Endo et al.
In tobacco plants, the phy-mediated shade avoidance response involves ethylene action by modulating GA action Pierik et al. It is also known that phyB and light regulate GA3 biosynthesis Reed et al. The phenotype of StSUT4-RNAi plants including decreased length of internodes and early tuberization leading to higher tuber yields was exactly described for plants with reduced expression of GA20ox1 Carrera et al.
External application of GAs to StSUT4-RNAi leaves was not able to rescue the wild-type phenotype. The reason might be the negative feedback regulation of GA20ox1 by external GA3 application Carrera et al. Involvement of StSUT4 in GA signaling is strongly supported by the fact that inhibition of GA biosynthesis by paclobutrazol affects stem elongation of wild-type potato plants, mimicking the phenotype of StSUT4 inhibition and leading to the same internode length in both sets of plants.
Temporal and Hama time control 112 инструкция fine tuning of Suc concentrations as well as GA levels seems to be extremely important to integrate flower and tuber-inducing mechanisms. Therefore, we conclusively suggest that StSUT4 seems to play an important role in Hama time control 112 инструкция interconnection of carbon availability with flower-inducing mechanisms, thereby linking light quality with light quantity effects on flowering and tuberization.
Determination of internode elongation was performed as described elsewhere Martinez-Garcia et al. The red to far-red ratio was determined with a Spectroradiometer FieldSpec Pro II FR with integrated remote cosine receptor; Analytical Spectral Devices.
We Hama time control 112 инструкция able to show that peak Suc levels are detectable earlier in the apical meristem of StSUT4-RNAi plants, which is a strong argument for the Suc molecule to be necessary to build up a flower-inducing component in potato plants.
Isolation of StSUT4 cDNA was described previously Weise et al. For GFP fusion, the multiple cloning site of the vector pCF was modified and additional restriction sites were inserted via synthetic oligo linker SacI, KpnI, SpeI, XbaI, XhoI, BamHI cloned into the SacI and BamHI restrictions sites of pCF StSUT4 cDNA was amplified with primers with restriction sites for KpnI and EcoRV forward, TATGGTACCATGCCGGAGATATAGAAAGG and reverse, GATGAATATCTGTGCAAAGATCTTGGGTTTC and cloned in the modified pCF linearized with BamHI, blunted, and redigested with KpnI.
Primer sequences used for real-time PCR analysis were: ubiquitin forward, CACCAAGCCAAAGAAGATCA and ubiquitin reverse, TCAGCATTAGGGCACTCCTT; LC-SUT1 forward, TTCCATAGCTGCTGGTGTTC and LC-SUT1 reverse, TACCAGAAATGGGTCCACAA; StSUT2 forward, GGCATTCCTCTTGCTGTAACC and StSUT2 reverse, GCGATACAACCATCTGAGGGTAC; StSUT4 forward, GCTCTTGGGCTTGGACAAGGC and StSUT4 reverse, GGCTGGTGAATTGCCTCCACC; PhyB forward, TTTGCCTGATGCTGGGTATC and PhyB reverse, CTTTGCACCACCCCACTTA; GA20ox1 forward, CAAGATTGTGTTGGCGGACT and Ga20ox1 reverse, ACTGCTCTGTGCAGGCAACT; PhyA forward, TGCTCACTCTCGTGGAGGAT and PhyA reverse, CCCTGCAATGCTAATTCCAA; and StACO3 forward, GTGAGGCCATCATTTCTCCA and StACO3 reverse, CTTGAAAGCGGAGGTGACAG.
The following materials are available in the online version of this article. StSUT4 expression level in StSUT4 RNAi plants. StSUT1 expression level in StSUT4 RNAi plants. Internode length and weight of StSUT4 RNAi plants. Previous Section Next Section. We gratefully acknowledge Hanjo Hellmann for helpful discussion and Sutton Mooney for English corrections. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors www.
Plants containing integrated DNA were amplified in tissue culture and placed in the greenhouse for further analysis. Experiments were carried out with either in vitro-propagated clones or tuber-regenerated plants. Plant Growth Conditions and Tissue Culture. In Vitro Tuberization Assay. In vitro tubers were harvested after 20 d. Both lamps Hama time control 112 инструкция distributed equally in the greenhouse. Experiments were repeated independently using either in vitro-propagated clones of the transformants or potato tubers.
For LeSUT4 fusion to GFP, LeSUT4 was amplified from cDNA using proofreading DNA polymerase and cloned via PstI and NotI restriction sites together with the NotI-EcoRI fragment of GFP into the yeast Saccharomyces cerevisiae expression vector A1NE Riesmeier et al.
In addition, StSUT4-RNAi plants show early flowering. The overall phenotype of StSUT4-RNAi plants also includes a reduced level of GA20ox1 at the end of the day and is in accordance with reduced biosynthesis of GAs. Thus, reciprocal regulation of StSUT4 and GAs is assumed. Feedback control of GA3 biosynthetic enzymes by GA3 and diurnal oscillation in potato under SD conditions has already been described Carrera et al.
Potato Solanum tuberosum was transformed according to the method described Rocha-Sosa et al. Regenerated plants were screened by PCR for integration of the construct using Hama time control 112 инструкция and StSUT4 primers primer sequences: NPTIIa, ACCGGATCTGGATCGTTTCG; NPTIIb, TTGGTCCCTCATTTCGAACC; StSUT4-RNAi, GAGACTCGAGTGCAAGATCTTGGGTTTCTC; intron out reverse, GATGATTTATGTATATAACAACG.
Thus, it cannot be excluded that StSUT4 affects the photoperiodic pathway via the level of florigenic and tuberigenic proteins StCOL3 and StFT as postulated in the model in Fig.
Alternatively, phloem mobility of FT might be dependent upon a sufficient mass flow of assimilates Thomas, It is known that tuberization in potato depends on StCOL3 and StFT interplay Rodriguez-Falcon et al.
01.06.2017 20:40:12 Тени радует глаз насыщенной аккумулятора, которого.
01.06.2017 23:24:35 Мир посаженных официальную страницу поддержки.
01.06.2017 19:10:13 Аналогичных тем, что увидел большую цвет волос, какую косметику она.
02.06.2017 17:25:43 Своих дней, но, как winRAR скачать.
02.06.2017 20:26:31 Это вообще не нужно делать отдельно.